Virus Packaging

Cloning Services

AAV quality services

Resources

About US

Current Location:Home > Products > Adenovirus
Premade Adenovirus for Human mir647, 1X10^12 viral particles/ml, 1ml

Premade Adenovirus for Human mir647, 1X10^12 viral particles/ml, 1ml

Gene No.: MIMAT0003317
Cat No.: VR221376
Gene Name: mir647; mir-647
Gene Length: 495 bp
Price: $1495
Turnaround Time: 10-15 days

  • Product Information
  • Mature Sequence
  • Cloning Sequence
  • Note To Purchase

Product name: human mirRNA adenovirus


Specifications: Titer:≥1×10E12vp/mL;Volume:500ul


Shipping & Storage Conditions:

Product(s) shipped on dry ice. Once received, please store at -80℃ for long-term storage. Please note, Aliquot to avoid repeated freezing and thawing that can decrease the viral titer. Prior to use, please melt it(or them) at 4℃ and mix gently to ensure a uniform concentration of components.
Once an aliquot is thawed, it may be stored at 4°C for several weeks without significant loss of biological activity.

Storage Buffer:PBS


Biosafety level:Biosafety level (BSL)-2


Shelf life:1 year from date of receipt under proper storage conditions


Note:If you have any questions about how to use the product, please refer to our adenovirus manual or contact our technical support. The email address is techsupport@wzbioscience.com.



GUGGCUGCACUCACUUCCUUC

GGGCCCGTCCACCAGCCGTCCAGCTTCCGGTGCCTGCATGAGTCTCCGCTTGGCCCTCTCCTCGGCCTAGGAACCCGCAGGTCTTGTCCCGTCAGGTTCCTCCTGAAGCTTTTGTTCTGAGAGGAAAAACTTTCCAGGGTTTCAAACTTGGAAAAACACCTGAACGCAGCCAGACACATTTTCCGTCGTCTGGTCAGCCAAGGAAGTGTTGGCCTGTGGCTGCACTCACTTCCTTCAGCCCCAGGAAGCCTTGGTCGGGGGCAGGAGGGAGGGTCAGGCAGGGCTGGGGGCCTGACCGCCCACACTCCTCCTCAGGCCTGCGGGGAACGCCCTGCTCCCCAACTAAGCAGCCTTCTCTTTGTTCTCTTCCTTCTCTCTGTAAACCCCCGTTTCCTGCCTTGTTCCCTCCCTGAACATGCTCTTCACCTGGCAAGCAGAGGAAGCTACGTTGGGATATGTGAGCAGTGTGCTCCGTGGTGCTGCTGTGTGACCCGC

WZ Biosciences' products are to be used only for research purpose only. They may not be used for any other purposes, including, but not limited to, in vitro diagnostic purposes, therapeutics, or in humans.


WZ Biosciences' products may not be transferred to any third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to other third parties without prior written approval from WZ Biosciences, Inc.

Your use of this product is also subject to compliance with the licensing requirements listed above and described on the product's web page at http://www.wzbio.com . It is your responsibility to review, understand and adhere to any restrictions imposed by these statements.