Products

Virus Packaging

Cloning Services

AAV quality services

Resources

About US

Current Location:Home > Products > Plasmid
Ready-to-package AAV shRNA clones,4 predesigned shRNA in pAV-U6-GFP vector + 1 negative control with scrambled sequences

Ready-to-package AAV shRNA clones,4 predesigned shRNA in pAV-U6-GFP vector + 1 negative control with scrambled sequences

Gene No.: NM_024551
Cat No.: SH877931
Gene Name: ADIPOR2; ACDCR2; FLJ21432; MGC4640; PAQR2
Gene Length: 1161 bp
Promotion Price: $600
Turnaround Time: 1-2 weeks

  • Product Information
  • DNA Sequence
  • siRNAs
  • Note To Purchase
Product name: Human shRNA Clone

Specifications: 500ul Glycerol Stock plus 5ug DNA

Shipping & Storage Conditions:
Product shipped at ambient temperature. Upon receiving, please store at -20 degree(for Plasmid) -80 degree(for Glycerol Stock) for long-term storage.

Product features:
1.For each shRNA, tranfection has been tested, green fluorescent has been observed;
2.All the shRNA clones includes ampicillin gene for positive clone selection. Its recommended working concentration is 50 ug/mL.

Handling instruction:
For glycerol stock, streak the bacteria onto an LB agar plate. Incubate at 37 °C for overnight. Inoculate a single colony into fresh LB medium and culture overnight at 37 °C in a shaking incubator. Then extract the plasmid and sequence verification.
For plasmid DNA, the Plasmid DNA product is usually provided as as liquid. Therefore, the Plasmid DNA is easily adsorbed on the surface of the tube during shipping. We strongly recommend spining the tube briefly to ensure that the liquid is at the bottom of the tube before opening. The Plasmid DNA product isn’t directly recommended for cell transfection. You can perform the transformation of the plasmid DNA and use a transfection-grade plasmid extraction kit for high-quality plasmid DNA preparation. Or you can choose our company's transfection-grade plasmid preparation service.

Note:If you have any questions about how to use the product, please contact our technical support. Our email address is techsupport@wzbioscience.com.

cgccatgaacGAGCCAACAGAAAACCGATTGGGGTGCAGCAGGACTCCAGAGCCAGATATAAGGCTCAGAAAAGGGCACCAACTGGATGGTACACGAAGAGGTGATAATGACAGCCACCAAGGAGATTTGGAGCCCATTTTAGAGGCATCTGTTCTATCTTCCCATCATAAAAAAAGCTCTGAGGAACATGAATACAGTGATGAAGCTCCTCAGGAAGATGAGGGCTTTATGGGCATGTCCCCTCTCTTACAAGCCCATCATGCTATGGAAAAAATGGAAGAATTTGTTTGTAAGGTATGGGAAGGTCGGTGGCGAGTGATCCCTCATGATGTACTACCAGACTGGCTCAAGGATAATGACTTCCTCTTGCATGGACACCGGCCTCCTATGCCTTCTTTCCGGGCCTGTTTTAAGAGCATTTTCAGAATACACACAGAAACAGGCAACATTTGGACACATCTCTTAGGTTGTGTATTCTTCCTGTGCCTGGGGATCTTTTATATGTTTCGCCCAAATATCTCCTTTGTGGCCCCTCTGCAAGAGAAGGTGGTCTTTGGATTATTTTTCTTAGGAGCCATTCTCTGCCTTTCTTTTTCATGGCTCTTCCACACAGTCTACTGCCACTCAGAGGGGGTCTCTCGGCTCTTCTCTAAACTGGATTACTCTGGTATTGCTCTTCTGATTATGGGAAGTTTTGTTCCTTGGCTTTATTATTCTTTCTACTGTAATCCACAACCTTGCTTCATCTACTTGATTGTCATCTGTGTGCTGGGCATTGCAGCCATTATAGTCTCCCAGTGGGACATGTTTGCCACCCCTCAGTATCGGGGAGTAAGAGCAGGAGTGTTTTTGGGCCTAGGCCTGAGTGGAATCATTCCTACCTTGCACTATGTCATCTCGGAGGGGTTCCTTAAGGCCGCCACCATAGGGCAGATAGGCTGGTTGATGCTGATGGCCAGCCTCTACATCACAGGAGCTGCCCTGTATGCTGCCCGGATCCCCGAACGCTTTTTCCCTGGCAAATGTGACATCTGGTTTCACTCTCATCAGCTGTTTCATATCTTTGTGGTTGCTGGAGCTTTTGTTCACTTCCATGGTGTCTCAAACCTCCAGGAGTTTCGTTTCATGATCGGCGGGGGCTGCAGTGAAGAggatgcactga

siRNA1: AACTGGATGGTACACGAAGAGGT
siRNA2: AATGGAAGAATTTGTTTGTAAGG
siRNA3: AACAGGCAACATTTGGACACATC
siRNA4: AAACTGGATTACTCTGGTATTGC

WZ Biosciences' products are to be used only for research purpose only. They may not be used for any other purposes, including, but not limited to, in vitro diagnostic purposes, therapeutics, or in humans.


WZ Biosciences' products may not be transferred to any third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to other third parties without prior written approval from WZ Biosciences, Inc.
Your use of this product is also subject to compliance with the licensing requirements listed above and described on the product’s web page at http://www.wzbio.com. It is your responsibility to review, understand and adhere to any restrictions imposed by these statements.